×
![]()
Genome Data
Primary Details
| Genome ID | GEN1 | ||||
| Plant Name | Ocimum tenuiflorum | ||||
| Description | De novo sequencing and characterization of Ocimum sanctum L. for better understanding of secondary metabolism pathways in the plants. | ||||
About Genome
| Field | Data | Plant Image |
|---|---|---|
|
||
| Platform | Illumina HiSeq 2000 | |
| Strategy | RNA-Seq | |
| Source | Genomic | |
| Library Name | CIMAP_ePCR1_Long | |
| Layout | Paired-end | |
| Spot Value | 224.6 | |
| Bases | 45.4 Gbp | |
| Size | 28.6 Gb | |
| GC Content Percentage | 38.37 | |
| Publish Data | 2014-11-14 | |
| External Database ID | SRR1653607 | |
| DNA C-Value | 0.36 | |
| Submitted By | Dr. Ajit Kumar Shasany, CSIR-CIMAP, Lucknow, India | |
Images
Description Details
Genomic Data
| Raw Data | |||
|---|---|---|---|
| Raw Sequence File | Genome_raw_data_sra | DOWNLOAD | |
| Raw Sequence File | Genome_raw_data_sra_lite_ncbi | DOWNLOAD | |
| Raw Data QC report | SRR1653607_1_fastqc | VIEW DOWNLOAD | |
| Raw Data QC report | SRR1653607_2_fastqc | VIEW DOWNLOAD | |
| Assembly Data | |||
| Primary analysis report | Primary analysis report | VIEW DOWNLOAD | |
| De-novo assembly report | De-novo assembly report | VIEW DOWNLOAD | |
| Gene prediction report of predicted proteins | Predicted genes | VIEW DOWNLOAD | |
| SSR prediction report | Predicted genes | VIEW DOWNLOAD | |
| Annotation of predicted proteins (UniProt) | Predicted genes | VIEW DOWNLOAD | |
| Functional Annotation Data | |||
| EST Annotation data | GT_SO_2054_EST_To_Scaffolds_Annotation | VIEW DOWNLOAD | |
| EST Annotation data | GT_SO_2054_TAIR_annotation_ChrC_ChrM | VIEW DOWNLOAD | |
| NR Annotation data | GT_SO_2054_Nicotiana_Tobacco_Predicted_Proteins_Annotation_NR | VIEW DOWNLOAD | |
| NR Annotation data | GT_SO_2054_Solanum_Tomato_Predicted_Proteins_Annotation_NR | VIEW DOWNLOAD | |
| Pfam HMM Annotation data | GT_SO_2054_Tobacco_pfamhmm | VIEW DOWNLOAD | |
| Pfam HMM Annotation data | GT_SO_2054_Tomato_pfamhmm | VIEW DOWNLOAD | |
| Predicted Protein Sequences 1 | GT_SO_2054_Scaf_gt_500_Augustus_parsed_tobacco.faa | VIEW DOWNLOAD | |
| Predicted Protein Sequences 1 | GT_SO_2054_Scaf_gt_500_Augustus_parsed_tobacco.gtf | VIEW DOWNLOAD | |
| Predicted Protein Sequences 2 | GT_SO_2054_Scaf_gt_500_Augustus_parsed_tomato.faa | VIEW DOWNLOAD | |
| Predicted Protein Sequences 2 | GT_SO_2054_Scaf_gt_500_Augustus_parsed_tomato.gtf | VIEW DOWNLOAD | |
| Pathway Annotation Data | |||
| Pathway Analysis Report | GT_SO_2054_Pathway_Analysis_report | VIEW DOWNLOAD | |
| Pathway Analysis Report | map00900 | VIEW DOWNLOAD | |
| Pathway Analysis Report | map00904 | VIEW DOWNLOAD | |
| Pathway Analysis Report | map00905 | VIEW DOWNLOAD | |
| Pathway Analysis Report | map00906 | VIEW DOWNLOAD | |
| Pathway Analysis Report | map00909 | VIEW DOWNLOAD | |
| KEGG Pathway Image | map00940 | VIEW DOWNLOAD | |
| KEGG Pathway Image | map00941 | VIEW DOWNLOAD | |
| Simple Sequence Repeats (SSR) Data | |||
| SSR Prediction Report 1 | GT_SO_2054_MISA_SSR_Prediction_Report | VIEW DOWNLOAD | |
| SSR Prediction Report 1 | GT_SO_2054_MISA_SSR_Prediction_Report_gt500 | VIEW DOWNLOAD | |
| SSR Prediction Report 1 | GT_SO_2054_MISA_SSR_Prediction_Report_gt500 | VIEW DOWNLOAD | |
| SSR Prediction Report 1 | GT_SO_2054_MISA_SSR_Prediction_Report_gt500 | VIEW DOWNLOAD | |
| SSR Prediction Report 1 | GT_SO_2054_MISA_SSR_Prediction_Report_gt500 | VIEW DOWNLOAD | |
Pathway Analysis Report Data
| Transcript id | KO id | Description | Pathway | Pathway function | Organism |
|---|---|---|---|---|---|
| scaffold1027_contigs=5:98011-101488 | K00162 | PDHB; pyruvate dehydrogenase E1 component subunit beta [EC:1.2.4.1] | 00010 Glycolysis / Gluconeogenesis [PATH:ath00010] | Carbohydrate metabolism | Arabidopsis thaliana |
| scaffold1027_contigs=5:100565-101488 | K00162 | PDHB; pyruvate dehydrogenase E1 component subunit beta [EC:1.2.4.1] | 00010 Glycolysis / Gluconeogenesis [PATH:ath00010] | Carbohydrate metabolism | Arabidopsis thaliana |
| scaffold1035_contigs=10:155874-162608 | K00873 | PK; pyruvate kinase [EC:2.7.1.40] | 00010 Glycolysis / Gluconeogenesis [PATH:ath00010] | Carbohydrate metabolism | Arabidopsis thaliana |
| scaffold1035_contigs=10:156149-161114 | K00873 | PK; pyruvate kinase [EC:2.7.1.40] | 00010 Glycolysis / Gluconeogenesis [PATH:ath00010] | Carbohydrate metabolism | Arabidopsis thaliana |
| scaffold1053_contigs=5:95713-100186 | K01689 | ENO; enolase [EC:4.2.1.11] | 00010 Glycolysis / Gluconeogenesis [PATH:ath00010] | Carbohydrate metabolism | Arabidopsis thaliana |
Predicted SSR Report Data
| Scaffold id | Type of ssr | Pattern of ssr | Size | ssr start position | ssr end position |
|---|---|---|---|---|---|
| scaffold1_contigs=5 | complex | (TA)21caa(AC)8 | 61 | 2226 | 2286 |
| scaffold1_contigs=5 | complex | (TA)16(GA)15 | 62 | 2815 | 2876 |
| scaffold1_contigs=5 | complex | (A)11gtaaataaagtagagtgcatttatttcttacttttagttgtagagaa(AT)6 | 70 | 12002 | 12071 |
| scaffold1_contigs=5 | complex | (G)11tgtgtggagtgctta(GT)6 | 38 | 56279 | 56316 |
| scaffold6_contigs=8 | complex | (TTA)12acacattttaaactactaagattttagcgcgagcgttcaatttacatattgaaatttataaattctttacagtt(A)10 | 120 | 1 | 120 |
Functional Annotation Report Data
| query_id | query_length | subject_id | subject_length | percentage_identity | alignment_length | query_coverage | subject_coverage | noof_mismatches | noof_gaps | query_start | query_end | subject_start | subject_end | e_value | score_entry | entry_name | protein_description | gene_names | ec_number | organism_name | pathway_name | protein_existence | protein_family | go_bp | go_mf | go_cc |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| g1.t1 | 296 | gi|527189837|gb|EPS61331.1| | 285 | 66.13 | 310 | 104.73 | 108.77 | 66 | 9 | 1 | 296 | 1 | 285 | 3.00E-125 | 370 | S8CAG2_9LAMI | Uncharacterized protein | M569_13466 | NA | Genlisea aurea | NA | Predicted | NA | GO:0003677~DNA binding;GO:0003682~chromatin binding | NA | NA |
| g4.t1 | 209 | gi|28209472|gb|AAO37490.1| | 547 | 41.18 | 238 | 113.88 | 43.51 | 108 | 2 | 1 | 206 | 308 | 545 | 4.00E-52 | 186 | Q850U9_ORYSJ | Putative gag-pol polyprotein (Putative polyprotein) | OSJNBa0037J17.27 OSJNBa0034E08.3 | NA | Oryza sativa subsp. japonica (Rice) | NA | Predicted | NA | GO:0003676~nucleic acid binding | NA | NA |
| g5.t1 | 211 | gi|299474487|gb|ADJ18449.1| | 1292 | 33.63 | 113 | 53.55 | 8.75 | 61 | 1 | 82 | 194 | 693 | 791 | 0.000000002 | 65.9 | E2GK51_BRYDI | Gag/pol protein (Fragment) | NA | NA | Bryonia dioica (Red bryony) (Bryonia cretica subsp. dioica) | NA | Predicted | NA | GO:0003676~nucleic acid binding;GO:0008270~zinc ion binding | GO:0015074~DNA integration | NA |
| g9.t1 | 230 | gi|28209472|gb|AAO37490.1| | 547 | 47.23 | 235 | 102.17 | 42.96 | 113 | 2 | 1 | 224 | 308 | 542 | 4.00E-66 | 224 | Q850U9_ORYSJ | Putative gag-pol polyprotein (Putative polyprotein) | OSJNBa0037J17.27 OSJNBa0034E08.3 | NA | Oryza sativa subsp. japonica (Rice) | NA | Predicted | NA | GO:0003676~nucleic acid binding | NA | NA |
| g16.t1 | 75 | gi|508716916|gb|EOY08813.1| | 207 | 50 | 70 | 93.33 | 33.82 | 35 | 0 | 3 | 72 | 136 | 205 | 4.00E-16 | 78.2 | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA |